actgccgtgaggacaaatatcattctgaggtga www.sym-bio.com Robert A. Feldman, Ph.D. Founder & CEO

SymBio Corporation Custom Genomics 6 employees > $1 M annual sales Founded 2003

In July, 2003, Dr. Robert A. Feldman founded SymBio Corporation; a project based custom genomics company specializing in high quality, high throughput DNA sequencing.  SymBio works collaboratively with academic and biotech researchers on projects ranging from deep-sea environmental microbiology to agricultural genomics.  Prior to opening his company, Robert developed a detailed business plan and discussed both the plan and his decision to go into business with several key persons, including his mother-in-law.  She recommended that he contact SCORE for advice.  During a counseling session at the San Jose Entrepreneur Center, Robert met counselor John Edwards.

During subsequent counseling sessions, the SymBio business plan was rigorously critiqued until Robert was convinced it made financial sense.  It was only then that he made the decision to open in the present site in Menlo Park, CA.  Several key members of his former genomics development lab at Amersham Biosciences eagerly joined the new company.  Keeping his high functioning and efficient team together was a major factor in smoothly starting operations.

From the beginning, SymBio had a large academic subcontract, but the next challenge was to develop a consistent strategy to increase sales beyond this initial contract. Here again "SCORE helped with counseling on ‘needs based’ selling.  John also recommended several helpful books including Rainmaker and The Negotiating Game."  Through the appropriate allocation of time for networking, marketing, and sales calls, Robert was able to successfully obtain several major sequencing projects for SymBio in the first year.  Within 1.5 years in operation, the company reached the breakeven milestone and was ready to grow.

"My SCORE mentor, who has extensive experience in high tech manufacturing, helped me at a critical time planning for increasing capacity.  This is just one example of the ‘Just in Time Counseling’ SCORE provides." 

Robert developed and implemented a capacity plan for growth and with a minimum of capital outlay; SymBio is now operating at nearly double its initial capacity.  Through its rapid growth, SymBio maintains efficient operations with low overhead allowing the team to continue providing highly flexible and custom service to their clients and collaborators.

"The four things I would say to anyone who is starting a business are:

1. Develop a realistic business plan; take a hard look at your assumptions. Then focus on the details and seek pragmatic feedback.
2. Make decisions that are best for the business.  Don’t let ego get in the way of asking for advice when you need it.
3. Focus on your core strength and outsource as much as you can.
4. Plan for best case, worst case and most probable to allow you to think of options.  Be flexible and work to the most probable cases.”

"My success in business has been significantly aided by the continuous counseling provided by my SCORE mentor during these first two years."

Read the Success Story of the Year about Sym-Bio